EnhancerDB
  1. Home
  2. TFBS
  3. ESR1[chr11:1790165-1790169]
Chromosome characteristics of ESR1[chr11:1790165-1790169]
Back to top
Enhancers possibly regulated by ESR1[chr11:1790165-1790169]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1788445 1806621 enh13684
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Pancreas Pancreas (Panc1) Uterus Thymus Epithelial (MCF-7)
SNP sites on ESR1[chr11:1790165-1790169]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1790167 rs552786488 G A 1796193
chr11 1790169 rs371234334 C CAGGAGCCGCTGACATGAGAAT 1796194
chr11 1790169 rs531769931 C CAGGAGCCGCTGACATGAGAAT 1796195
Genes possibly regulated by ESR1[chr11:1790165-1790169]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESR1[chr11:1790165-1790169]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results