Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2693465 2700688 enh1609

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2693603 rs143094382 ATATGATTGAGCTCAGGCTGG A 1804828

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results