| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 3850985 | 3860835 | enh1616 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 3859712 | rs142633216 | GAAAGTGCCTTGTATGCACATCCTTCTCTA | G | 1812062 | |
| chr11 | 3859712 | rs75569785 | GAAAGTGCCTTGTATGCACATCCTTCTCTA | G | 1812063 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr11 | 3848208 | 3862213 | - | RHOG | ENSG00000177105.9 | 3862213 | 0.83 | 1.0 | 2498 | 10435 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|