Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10420878 rs68031418 TTAATGTACATATGTATGCA T 1840740
chr11 10420883 rs372677552 G A 1840741

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results