EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr11:10603937-10603948]
Chromosome characteristics of TFAP2C[chr11:10603937-10603948]
Back to top
Enhancers possibly regulated by TFAP2C[chr11:10603937-10603948]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10600225 10612755 enh13759
Bone Marrow (K562) Prostate (PC-3) Esophagus Stomach Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Pancreas Uterus Epithelial (MCF-7)
SNP sites on TFAP2C[chr11:10603937-10603948]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10603944 rs368391871 AGGCACATTGTAATGTGCTGGG A 1841950
chr11 10603944 rs370758283 AGGCACATTGTAATGTGCTGGG A 1841951
Genes possibly regulated by TFAP2C[chr11:10603937-10603948]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr11:10603937-10603948]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results