Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 61674625 61686555 enh13963

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 61684611 rs568993778 TCGGCTGCCCACCCTTCGCA T 2027495

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 61664773 61687741 - RAB3IL1 ENSG00000167994.7 61687741 0.81 1.0 3119 10948


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results