Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 65412232 65425595 enh98818

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 65414676 rs539929067 AGGCCGGAACTGGTGCCCTCG A 2047320

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results