Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 77145025 77164515 enh14122

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 77155563 rs550872429 CTAACTCTTTGTAAACTCATCACAAT C 2123497

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results