Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 113243365 113251024 enh2015

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 113249626 rs571925997 GTTCATTCATCCATTCATTCATTCA G 2272224

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results