EnhancerDB
  1. Home
  2. TFBS
  3. ESRRA[chr11:114067123-114067134]
Chromosome characteristics of ESRRA[chr11:114067123-114067134]
Back to top
Enhancers possibly regulated by ESRRA[chr11:114067123-114067134]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 114063206 114073392 enh62210
Epithelial (MCF-7) Prostate (RWPE1) Esophagus Liver Lung Stomach Muscle (A673) Thyroid Pancreas Muscle (Myoblast) Breast Uterus Blood (T-cell) Heart
SNP sites on ESRRA[chr11:114067123-114067134]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 114067125 rs150734990 C CAAAGAAACAGACAAAGATAGCT 2276713
chr11 114067125 rs60895547 C CAAAGAAACAGACAAAGATAGCT 2276714
Genes possibly regulated by ESRRA[chr11:114067123-114067134]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESRRA[chr11:114067123-114067134]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results