Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 118581525 118592015 enh2035

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 118591994 rs543637131 CTTTGCATCATAGACGAGGTAAAGGAT C 2299873

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results