EnhancerDB
  1. Home
  2. TFBS
  3. HNF4A[chr11:118591981-118591996]
Chromosome characteristics of HNF4A[chr11:118591981-118591996]
Back to top
Enhancers possibly regulated by HNF4A[chr11:118591981-118591996]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 118581525 118592015 enh2035
Bone Marrow (K562) Large Intestine Ovary Esophagus Thyroid Blood (Karpas-422) Lung (PC-9) Neural Stem Cells (H9) Stomach
SNP sites on HNF4A[chr11:118591981-118591996]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 118591994 rs543637131 CTTTGCATCATAGACGAGGTAAAGGAT C 2299873
Genes possibly regulated by HNF4A[chr11:118591981-118591996]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HNF4A[chr11:118591981-118591996]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results