Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121911745 121922999 enh29212

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121918571 rs185698029 C A 2321050
chr11 121918587 rs147525633 GTTTTATTTTATTTTATTTTA G 2321051

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results