Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 126053225 126069818 enh2088

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 126053257 rs371373715 G GTGCAGTGATGCAATCTTGGCTTAC 2344756
chr11 126053257 rs556954482 G GTGCAGTGATGCAATCTTGGCTTAC 2344757

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results