Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 428626 438975 enh56551

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 437798 rs532306081 CATCTAAGATGCAGAAAACCTA C 10221608

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results