EnhancerDB
  1. Home
  2. TFBS
  3. NHLH1[chr8:11300139-11300151]
Chromosome characteristics of NHLH1[chr8:11300139-11300151]
Back to top
Enhancers possibly regulated by NHLH1[chr8:11300139-11300151]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 11281762 11322135 enh10162
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Blood (T-cell) Stomach Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Prostate (RWPE1) Heart
SNP sites on NHLH1[chr8:11300139-11300151]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 11300147 rs542859321 TGGGGGCTGTGCGCGGTCTGTCCTG T 10283158
chr8 11300151 rs190806786 G C 10283159
Genes possibly regulated by NHLH1[chr8:11300139-11300151]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NHLH1[chr8:11300139-11300151]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results