Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 11442574 11461223 enh24746

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 11460966 rs539236565 G GGGAGGATCACCTAAGCCTGGGTGAT 10285838

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results