Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 11691065 11699175 enh7003

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 11691367 rs533822474 CTATTTGGTTTGGTTTGGTTTGGTTT C 6550733
chr3 11691368 rs539964696 T G 6550734
chr3 11691369 rs73814969 A G 6550735

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results