Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 124639685 124649715 enh25268

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 124647020 rs555694998 G GAGATCTGGCTAGCCAGACCTAGCC 10733526

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results