EnhancerDB
  1. Home
  2. TFBS
  3. PKNOX1[chr8:124921986-124921998]
Chromosome characteristics of PKNOX1[chr8:124921986-124921998]
Back to top
Enhancers possibly regulated by PKNOX1[chr8:124921986-124921998]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 124917465 124927215 enh46647
Prostate (PC-3) Large Intestine Stomach Muscle (Myotube) Uterus Epithelial (MCF-7)
SNP sites on PKNOX1[chr8:124921986-124921998]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 124921989 rs66461343 ATAGCTGTCCTTGTCAACTAGGGGATGATG A 10735174
chr8 124921989 rs67039916 ATAGCTGTCCTTGTCAACTAGGGGATGATG A 10735175
Genes possibly regulated by PKNOX1[chr8:124921986-124921998]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PKNOX1[chr8:124921986-124921998]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results