Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 124917465 124927215 enh46647

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 124921989 rs66461343 ATAGCTGTCCTTGTCAACTAGGGGATGATG A 10735174
chr8 124921989 rs67039916 ATAGCTGTCCTTGTCAACTAGGGGATGATG A 10735175

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results