EnhancerDB
  1. Home
  2. TFBS
  3. ESR1[chr8:125264232-125264236]
Chromosome characteristics of ESR1[chr8:125264232-125264236]
Back to top
Enhancers possibly regulated by ESR1[chr8:125264232-125264236]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 125263485 125286515 enh10509
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Bone (Osteoblast) Lung (A549) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Spleen Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ESR1[chr8:125264232-125264236]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 125264233 rs537902613 G GGTCAGCATTGTACCCAAGGCTGGT 10737101
Genes possibly regulated by ESR1[chr8:125264232-125264236]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESR1[chr8:125264232-125264236]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results