Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 1287771 1301075 enh60642

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1299656 rs570465935 TGCAGTGGGCCGAGATTGTGCCACTTCAATAAA T 4693530

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 1247566 1303672 - YWHAE ENSG00000108953.12 1303672 0.79 0.99 4008 15215


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results