EnhancerDB
  1. Home
  2. TFBS
  3. HINFP[chr17:1299645-1299657]
Chromosome characteristics of HINFP[chr17:1299645-1299657]
Back to top
Enhancers possibly regulated by HINFP[chr17:1299645-1299657]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 1287771 1301075 enh60642
Bone Marrow (K562) Cervix (HeLa-S3) Esophagus Liver Blood (OCI-LY7) Stomach Muscle (A673) Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Uterus Heart
SNP sites on HINFP[chr17:1299645-1299657]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1299656 rs570465935 TGCAGTGGGCCGAGATTGTGCCACTTCAATAAA T 4693530
Genes possibly regulated by HINFP[chr17:1299645-1299657]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 1247566 1303672 - YWHAE ENSG00000108953.12 1303672 0.79 0.99 4015 15215
Expression level of Genes
Back to top
miRNAs possibly regulated by HINFP[chr17:1299645-1299657]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results