Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 4499365 4510295 enh16942

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 4502948 rs531822030 GATGCCCCGGGCCATGGGGTGGTGGCCCC G 4714354
chr17 4502961 rs72832028 A G 4714355

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results