Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 123961925 123971255 enh20870

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 123965364 rs534379915 TTGGCTGGTTGTGTAGTCAGTTCTGGCA T 6995736

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results