EnhancerDB
  1. Home
  2. TFBS
  3. LHX6[chr17:27539763-27539773]
Chromosome characteristics of LHX6[chr17:27539763-27539773]
Back to top
Enhancers possibly regulated by LHX6[chr17:27539763-27539773]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 27537765 27549799 enh58745
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Colon (HCT116) Breast
chr17 27539560 27540084 vista24333
VISTA
SNP sites on LHX6[chr17:27539763-27539773]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 27539764 rs373219496 G GCTGATTAGTATCATTGTGTCATCCA 4815654
chr17 27539764 rs550043951 G GCTGATTAGTATCATTGTGTCATCCA 4815655
Genes possibly regulated by LHX6[chr17:27539763-27539773]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LHX6[chr17:27539763-27539773]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results