EnhancerDB
  1. Home
  2. TFBS
  3. PRDM1[chr17:31201318-31201333]
Chromosome characteristics of PRDM1[chr17:31201318-31201333]
Back to top
Enhancers possibly regulated by PRDM1[chr17:31201318-31201333]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 31194505 31202459 enh62608
Esophagus Stomach Muscle (Myoblast) Pancreas Uterus Heart
SNP sites on PRDM1[chr17:31201318-31201333]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 31201322 rs56308141 C CTCTCTCTCTCTCTGTGTCTCTG 4833046
chr17 31201322 rs6146033 C CTCTCTCTCTCTCTGTGTCTCTG 4833047
Genes possibly regulated by PRDM1[chr17:31201318-31201333]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 30819540 31204195 - MYO1D ENSG00000176658.12 31204195 0.74 1.0 2862 15638
Expression level of Genes
Back to top
miRNAs possibly regulated by PRDM1[chr17:31201318-31201333]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results