Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 34294605 34303338 enh52484

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 34298905 rs56400481 GGCTCAGAAAGGTTAAGGCTATT G 4846362
chr17 34298905 rs67873052 GGCTCAGAAAGGTTAAGGCTATT G 4846363

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results