Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 35804199 35816940 enh32182

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 35805815 rs555517558 A AACTACATACTAATATATACTAAT 4852660

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results