Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 39829087 rs544167949 CGCCTCCCGGGTTCACACCATTCTCCTGCCTCA C 4874470
chr17 39829091 rs147524019 T C 4874471

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results