EnhancerDB
  1. Home
  2. TFBS
  3. NFY[chr17:40670286-40670291]
Chromosome characteristics of NFY[chr17:40670286-40670291]
Back to top
Enhancers possibly regulated by NFY[chr17:40670286-40670291]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 40666365 40672295 enh17163
Bone Marrow (K562) Skin (Keratinocyte) Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Ovary Esophagus Bone (Osteoblast) Muscle (A673) Placenta Lung (PC-9) Pancreas Uterus Thymus Kidney
SNP sites on NFY[chr17:40670286-40670291]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 40670287 rs539667295 GATTGGGTGGTGATTAAAGGGACAGA G 4879178
Genes possibly regulated by NFY[chr17:40670286-40670291]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFY[chr17:40670286-40670291]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results