EnhancerDB
  1. Home
  2. TFBS
  3. RFX3[chr17:44133935-44133951]
Chromosome characteristics of RFX3[chr17:44133935-44133951]
Back to top
Enhancers possibly regulated by RFX3[chr17:44133935-44133951]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 44127185 44143079 enh32208
Skin (Keratinocyte) Prostate (PC-3) Prostate (RWPE1) Astrocyte Thyroid Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Neural Stem Cells (H9) Thymus Epithelial (MCF-7)
SNP sites on RFX3[chr17:44133935-44133951]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 44133936 rs542071356 C CA 4898812
chr17 44133937 rs530116083 G A,T 4898813
chr17 44133950 rs142958693 CTGATAGAACATTTACCATCAAACT C 4898814
Genes possibly regulated by RFX3[chr17:44133935-44133951]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX3[chr17:44133935-44133951]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results