Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 44127185 44143079 enh32208

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 44133936 rs542071356 C CA 4898812
chr17 44133937 rs530116083 G A,T 4898813
chr17 44133950 rs142958693 CTGATAGAACATTTACCATCAAACT C 4898814

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results