Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47691325 47695715 enh65049

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47693267 rs149077441 AATGAAGAAAACAGAACTAAACCTAGCT A 4917137

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results