Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48333165 48343735 enh44448

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48336374 rs141302101 CAGCCCTCTCCATCCCGGTGGAAAGAGG C 4921926

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results