Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48854945 48879175 enh17223

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48859142 rs200335002 CTATTTTATTTTATTTTATTTTATTT C 4925373
chr17 48859142 rs869121342 CTATTTTATTTTATTTTATTTTATTT C 4925374

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results