EnhancerDB
  1. Home
  2. TFBS
  3. POU2F1[chr17:48859134-48859146]
Chromosome characteristics of POU2F1[chr17:48859134-48859146]
Back to top
Enhancers possibly regulated by POU2F1[chr17:48859134-48859146]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48854945 48879175 enh17223
Skin (Keratinocyte) Prostate (RWPE1) Blood (T-cell) Esophagus Stomach Muscle (A673) Placenta Thyroid Pancreas Spleen Thymus Heart
SNP sites on POU2F1[chr17:48859134-48859146]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48859142 rs200335002 CTATTTTATTTTATTTTATTTTATTT C 4925373
chr17 48859142 rs869121342 CTATTTTATTTTATTTTATTTTATTT C 4925374
Genes possibly regulated by POU2F1[chr17:48859134-48859146]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU2F1[chr17:48859134-48859146]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results