EnhancerDB
  1. Home
  2. TFBS
  3. FLI1[chr17:53515134-53515145]
Chromosome characteristics of FLI1[chr17:53515134-53515145]
Back to top
Enhancers possibly regulated by FLI1[chr17:53515134-53515145]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 53505736 53535115 enh4475
Brain (SK-N-MC) Liver Colon (HCT116) Blood (Karpas-422) Pancreas Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Heart
SNP sites on FLI1[chr17:53515134-53515145]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 53515136 rs11268050 C CATTCCTCTTGGGTAGAAAG 4939285
chr17 53515136 rs144355025 C CATTCCTCTTGGGTAGAAAG 4939286
Genes possibly regulated by FLI1[chr17:53515134-53515145]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FLI1[chr17:53515134-53515145]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results