EnhancerDB
  1. Home
  2. TFBS
  3. JUND[chr17:63471017-63471032]
Chromosome characteristics of JUND[chr17:63471017-63471032]
Back to top
Enhancers possibly regulated by JUND[chr17:63471017-63471032]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63447796 63471295 enh17306
Lung Placenta Thyroid Uterus Lung (PC-9) Breast Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on JUND[chr17:63471017-63471032]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63471025 rs75180144 A C,T 4991438
chr17 63471031 rs562257599 GGACAATCACAGGTCTGATCTCTC G 4991439
Genes possibly regulated by JUND[chr17:63471017-63471032]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by JUND[chr17:63471017-63471032]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results