EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr17:70356536-70356557]
Chromosome characteristics of ZNF263[chr17:70356536-70356557]
Back to top
Enhancers possibly regulated by ZNF263[chr17:70356536-70356557]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 70352230 70433435 enh4580
Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on ZNF263[chr17:70356536-70356557]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 70356549 rs375982928 CGCTCCCTCTCCACACAGTGCATAGAGTTT C 5033352
chr17 70356549 rs576018124 CGCTCCCTCTCCACACAGTGCATAGAGTTT C 5033353
chr17 70356550 rs140268289 G A 5033354
Genes possibly regulated by ZNF263[chr17:70356536-70356557]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr17:70356536-70356557]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results