Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 70424122 rs374264554 A AAATGAGTTGATTCAACTAAATC 5034256
chr17 70424122 rs577853684 A AAATGAGTTGATTCAACTAAATC 5034257

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results