Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73370398 73383315 enh17375

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73383068 rs200620473 A AACACAGTGAAACCCCGTCTCT 5056456
chr17 73383068 rs6146152 A AACACAGTGAAACCCCGTCTCT 5056457

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results