EnhancerDB
  1. Home
  2. TFBS
  3. FOXP1[chr17:73383066-73383081]
Chromosome characteristics of FOXP1[chr17:73383066-73383081]
Back to top
Enhancers possibly regulated by FOXP1[chr17:73383066-73383081]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73370398 73383315 enh17375
Liver (HepG2) Large Intestine Liver Blood (OCI-LY7) Placenta Lung (PC-9) Neural Stem Cells (H9) Stomach
SNP sites on FOXP1[chr17:73383066-73383081]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73383068 rs200620473 A AACACAGTGAAACCCCGTCTCT 5056456
chr17 73383068 rs6146152 A AACACAGTGAAACCCCGTCTCT 5056457
chr17 73383075 rs574191281 AAC A 5056458
Genes possibly regulated by FOXP1[chr17:73383066-73383081]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXP1[chr17:73383066-73383081]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results