Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 78418565 78432855 enh4627

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 78421879 rs574213007 TCCCTCAAAGGCAGTTCTGAGGTCA T 5101782

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results