EnhancerDB
  1. Home
  2. TFBS
  3. E2F6[chr17:79019316-79019327]
Chromosome characteristics of E2F6[chr17:79019316-79019327]
Back to top
Enhancers possibly regulated by E2F6[chr17:79019316-79019327]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79008825 79027145 enh17433
Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Lung Muscle (A673) Heart
SNP sites on E2F6[chr17:79019316-79019327]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79019320 rs150198077 C T 5109158
chr17 79019320 rs531697480 C CGGGAGGCCACCTGCTCCTGGT 5109159
chr17 79019321 rs72851899 G A,C 5109160
Genes possibly regulated by E2F6[chr17:79019316-79019327]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by E2F6[chr17:79019316-79019327]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results