Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 110962345 110978755 enh15496

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 110969217 rs548109093 A ACATGTAAAACATAGATATGTAT 3392937

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results