Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 111092445 111098896 enh51723

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 111095150 rs11273446 T TGTTATTTTATAATTTTGAAATAACTCCACAGA 3394701
chr13 111095150 rs571123220 T TGTTATTTTATAATTTTGAAATAACTCCACAGA 3394702

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results