Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114060593 114075215 enh3025

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114063154 rs536372099 C CAGGGGAGGAGGGGGCTGCAGAGAGG 3410271

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results