Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114551105 114565888 enh15515

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114559780 rs151241374 GGCAGGAATGCCACACCGCA G 3413245
chr13 114559780 rs534887998 GGCAGGAATGCCACACCGCA G 3413246

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results