Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 76084970 rs367961427 C CTCTTTATTTTTTTTATTTTTTTTAT 8320541
chr5 76084979 rs558296392 G A 8320542

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results