Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 93573105 93588915 enh38124

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 93583218 rs184065706 G T 8382499
chr5 93583221 rs144803825 AGGAAGATGTCAGGAAACCTTT A 8382500

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results